DBCLS OpenID URL:     |     |   日本語
Max. Results:
Sort by : Relevance  Updated  Rating 
Search Options :
Help     
Search Result for "aging lifespan longevity senescence" Sort by : [  Relevance  |  Updated  |  Rating  ]
[ 1 ] www.h2020awe.eu  
Updated: (Jul 6, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
27040825 http://www.h2020awe.eu/ text/html; charset=utf-8 Ageing with elegans | Discovering molecular pathways underlying healthy ageing for prevention, diagnosis, and treatment. Discovering molecular...h2020awe.eu/ text/html; charset=utf-8 Ageing with elegans | Discovering molecular pathways underlying healthy ageing for prevention, diagnosis, and treatment. Discovering molecular pathways underlying healthy ageing for prevention, diagnosis, and...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 2 ] AnAge: The Animal Ageing and Longevity Database  
Updated: (Jul 24, 2009)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
19522730 http://genomics.senescence.info/species/ text/html; charset=us-ascii AnAge: The Animal Ageing and Longevity DatabaseGenomicsGenAgeA curated database of candidate human ageing-related genes and genes associated with longevity and/or ageing in model organisms.Search humanSearch model organismsGenDRA curated database of genes associated with dietary restriction...or gene expression profiling.Search gene manipulationsSearch gene expressionLongevityMapDatabase of human genetic variants associated with longevity.Search genes/variantsCellAgeDatabase of human genes associated with cellular senescence.Search CellAgeGene ExpressionProjects focused on...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 3 ] GenDR: The Dietary Restriction Gene Database  
Updated: (Aug 22, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
22912585 http://genomics.senescence.info/diet/ text/html; charset=us-ascii GenDR: The Dietary Restriction Gene DatabaseGenomicsGenAgeA curated database of candidate human ageing-related genes and genes associated with longevity and/or ageing in model organisms.Search humanSearch model organismsGenDRA curated database of genes associated with dietary restriction...To receive the latest news and announcements, please join the HAGR-news mailing list.Human Ageing Genomic ResourcesHomeAbout UsDisclaimerDownloadsFeedbackHelpLinksMailing ListNewsPublicationsScienceDatabasesGene Database (GenAge)Species Database (AnAge)Dietary Restriction Database (GenDR)Longevity Variants Database (LongevityMap)Cell Senescence Database (CellAge)Drugs Database (DrugAge)External DatabasesDigital Ageing AtlasLibAge (beta version)ProjectsGene ExpressionCancerGenome SequencingEvolution of...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 4 ] GenAge: The Ageing Gene Database  
Updated: (Jul 28, 2004)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
15280050 http://genomics.senescence.info/genes/ text/html; charset=us-ascii GenAge: The Ageing Gene DatabaseGenomicsGenAgeA curated database of candidate human ageing-related genes and genes associated with longevity and/or ageing in model organisms.Search humanSearch model organismsGenDRA curated database of genes associated with dietary restriction...or gene expression profiling.Search gene manipulationsSearch gene expressionLongevityMapDatabase of human genetic variants associated with longevity.Search genes/variantsCellAgeDatabase of human genes associated with cellular senescence.Search CellAgeGene ExpressionProjects focused on gene expression profiling of ageing and of dietary manipulations of ageing, such as caloric restriction. Genomes Information on developing genomic...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
GenAge: a genomic and proteomic network map of human ageing.   Paper Page   (Jul 30, 2004)  
[ 5 ] LongevityMap: The Database of Genetic Variants Associated with Longevity  
Updated: (Sep 24, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
23998809 http://genomics.senescence.info/longevity/ text/html; charset=us-ascii LongevityMap: The Database of Genetic Variants Associated with LongevityGenomicsGenAgeA curated database of candidate human ageing-related genes and genes associated with longevity and/or ageing in model organisms.Search humanSearch model organismsGenDRA curated database of genes associated with dietary restriction...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 6 ] MitoAge | Home  
Updated: (Jan 7, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...DNA (mtDNA), together with accumulated data on longevity records, provide new fascinating opportunities for the analysis of the links between mtDNA features and longevity across animals. To facilitate such an analysis...mtDNA data records, and integrated it with longevity records. The MitoAge website also provides the...mtDNA, with a special focus on animal longevity. Why is it important? Mitochondria are the...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 7 ] The Jackson Laboratory Nathan Shock Center of Excellence in the Basic Biology of Aging  
Updated: (Sep 1, 2011)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...of Excellence in the Basic Biology of Aging HomeRESEARCHWithin the CenterEllison ScholarsAt the Jackson LaboratoryPUBLICATIONSCORESAnimal...and Translational Coresperform a comprehensive survey of lifespan and healthspan in the mouse and other...of mouse models for research on biological aging Statistical Coreenables the tracking, statistical analysis and dissemination of aging data Development Coresupports investigators who wish to change career direction towards aging researchAnnouncementsDelayed female sexual maturity linked to longer lifespan in mice, Jackson Laboratory researchers reportMay 7, 2012An intriguing clue to longevity lurks in the sexual maturation timetable of...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 8 ] NetEffects  
Updated: (Dec 19, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Analysing the effects of gene perturbations on longevity via the Insulin Pathway IntroductionPathways represent sequences...and Caenorhabtitis elegans and their role in lifespan. NetEffects provides two different ways of studying each pathway:Querying it by up- or down-regulating specific components.Importing gene expression data and phenotype information (lifespan extension/reduction) and inferring the effects on...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 9 ] WebCite query result  
Updated: (Apr 28, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...van CCT (UK)The Active and Healthy Aging Study (Dutch: Actief en Gezond Oud Studie...METC LUMC- Public TitleThe Active and Healthy Aging Study (Dutch: Actief en Gezond Oud Studie...Oud Studie).- Scientific TitleThe Active and Healthy Aging Study (Dutch: Actief en Gezond Oud Studie...coaching combined with accelorometry of inactive individuals aged 60-70 years is effective in increasing...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 10 ] WebCite query result  
Updated: (Dec 9, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...van CCT (UK)The Active and Healthy Aging Study (Dutch: Actief en Gezond Oud Studie...METC LUMC- Public TitleThe Active and Healthy Aging Study (Dutch: Actief en Gezond Oud Studie...Oud Studie).- Scientific TitleThe Active and Healthy Aging Study (Dutch: Actief en Gezond Oud Studie...coaching combined with accelorometry of inactive individuals aged 60-70 years is effective in increasing...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 11 ] 43  
Updated: (Nov 15, 2011)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...21st century [4, 5]; they affect all ... groups [6] and their burden is greater...complex gene-environment interactions acting across the lifespan from the fetus to old ... (Figure 1). In this context, 'environment' includes...modulated by socio-economic determinants, psychological factors, ... and gender. The products of these interactions...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Systems medicine and the public's health.   Paper Page   (2011)  
[ 12 ] NetAge  
Updated: (Jul 8, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...usDownloadSearch: A man ninety years old was asked to what he attributed his longevity. "I reckon," he said, with a twinkle in his eye, "It's because most...microRNA-regulated protein-protein interaction networks which are involved in complex processes of aging and ...-related diseases, and ultimately in the determination of longevity.By making these resources available online, we hope to provide the scientific community...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 13 ] JenAge Ageing Factor Database  
Updated: (Dec 30, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
24217911 http://agefactdb.jenage.de/ text/html; charset=us-ascii JenAge Ageing Factor Database Research Centre Information Centre AgeFactDBHomeAboutAdvanced SearchBrowseDownloadReleaseHelpContributeContactImprintRelease 1 - Aug 15, 2013 Quick SearchAgeing-related Sources Lifespan Observations Database GenAge GenDR AgeFactDB Curator AgeFactDB Homology Analysis All | NoneAgeing Relevance Evidence Experimental Both Computational Any Result List Type Ageing Factor Observation BrowseAgeing Factors (16599)Genes (16450)Compounds (91)Other Ageing Factors (58)Observations (9611)Ageing Phenotype (8159)Data Type 1 (940...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 14 ] full  
Updated: (Apr 4, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...for example antioxidant, anti-inflammation and anti-aging, release of neurotransmitter and neuromodulator, modulate mitochondrial...mimic a calorie-restriction diet that extends lifespan and stress resistance by linking to the longevity gene SIRT1. SIRT1 is one member of the mammalian family of Sirtuins, a highly conserved family of NAD+-dependent deacetylases that regulate cellular energy and lifespan in both lower organisms and mammals (Wood...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 15 ] LIFESPAN | Computer-Aided Design for Longitudinal Studies  
Updated: (Apr 8, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
25852596 http://www.brandmaier.de/lifespan/ text/html; charset=utf-8 LIFESPAN | Computer-Aided Design for Longitudinal StudiesLIFESPANComputer-Aided Design for Longitudinal StudiesMenuSkip to contentHomeInstallationReferencesDownloadsLIFESPAN: Longitudinal Study PlannerThe Longitudinal Interactive Front End Study Planner (LIFESPAN) enables researchers to sketch a longitudinal study...reliability measures for hypotheses about change. Currently, LIFESPAN is limited to latent growth curve models...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 16 ] FACES 3.3.1 build date 2010-07-20 15:17:02  
Updated: (Feb 17, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...database of facial expressions in younger, middle-aged, and older women and menWhat is FACES?FACES is a set of images of naturalistic faces of 171 younger (n = 58), middle-aged (n = 56), and older (n = 57) women...and Michaela Riediger at the Center for Lifespan Psychology, Max Planck Institute for Human Development...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 17 ] Regulation of metabolism in Caenorhabditis elegans longevity | Journal of Biology | Full Text  
Updated: (Mar 1, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...1186/jbiol215 text/html; charset=utf-8 Regulation of metabolism in Caenorhabditis elegans longevity | Journal of Biology | Full TextSkip to main contentAdvertisement Login to your account SearchSearch...February 2010AbstractThe nematode Caenorhabditis elegans is a favorite model for the study of aging. A wealth of genetic and genomic studies show that metabolic regulation is a hallmark of life-span modulation. A recent study in BMC Biology identifying metabolic signatures for longevity suggests that amino-acid pools may be important in longevity.See research article http://www.biomedcentral.com/1741-7007/8/14.Aging in...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
A metabolic signature of long life in Caenorhabditis elegans.   Paper Page   (Feb 10, 2010)  
[ 18 ] The Bowhead Whale Genome Resource  
Updated: (Jan 8, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...remain disease-free until much more advanced ages than humans can. Searching the genomeSearchShow search...BLAST search page »The mechanisms for the longevity and resistance to aging-related diseases of bowhead whales are unknown, but it is clear these animals must possess aging prevention mechanisms. In particular in context of cancer, bowhead whales must have anti-tumour mechanisms, because given their large size and longevity, their cells must have a massively lower...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 19 ] www.t2diabetesgenes.org  
Updated: (May 10, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...for: Type 2 Diabetes, Obesity, growth & reproductive ageing geneticsJanuary 26, 2016 rob Leave a commentWe...team also have interests in female reproductive lifespan including ... at Menopause; ii) to use human genetics...Recent PostsType 2 Diabetes, Obesity, growth & reproductive ageing geneticsRecent CommentsArchivesJanuary 2016CategoriesUncategorizedMetaLog inEntries RSSComments RSSWordPress.orgProudly...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 20 ] Aging.AI | Deep Biomarkers Of Human Aging  
Updated: (Jun 10, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
27191382 http://www.aging.ai/ text/html; charset=utf-8 Aging.AI | Deep Biomarkers Of Human Aging Deep Biomarkers Of Human Aging How old by basic blood testAging.AI...is a deep-learned predictor of your ... made with a deep neural network trained on hundreds of thousands anonymized human blood tests. Enter your data below and Aging.ai will guess your ... and gender First choose the sample metric...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 21 ] WebCite query result  
Updated: (Aug 7, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...tested with a sample of young adults (ages 18-35) who smoke. Final assessments will...  BothAccepts Healthy Volunteers:   YesCriteriaInclusion Criteria:... 18 to 35Current daily smokerHas a cell...Beth C Bock, PhD401-793-8020bbock@lifespan.orgLocationsUnited States, Rhode IslandThe Miriam HospitalRecruitingProvidence, Rhode Island, United States, 02903 Contact: Beth C Bock, PhD     401-793-8020     bbock@lifespan.org     Principal Investigator: Beth C...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 22 ] ALSWH Home Home  
Updated: (Dec 17, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...000 women in three cohorts who were aged 18-23, 45-50 and 70-75 when surveys began in 1996. In 2012/13 more than 17,000 young women aged 18-23 were recruited to form a...about the health of women across the lifespan, and informed federal and state government policies...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 23 ] The Future of Nursing IOM Report - Campaign for Action | Campaign for Action  
Updated: (Sep 2, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...change to meet the needs of an aging, increasingly diverse population and to respond to a complex, evolving health care system. The recommendations in the report focus on the critical intersection between the health needs of patients across the lifespan and the readiness of the nursing workforce...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 24 ] European Policies and Initiatives | Healthy Ageing  
Updated: (Jul 6, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...text/html; charset=utf-8 European Policies and Initiatives | Healthy AgeingJump to navigation Search Healthy Ageing HomeSteps to Healthy AgeingHealthy Ageing Good PracticesEU Initiatives EIP/AHAPublications & LinksFollow UsYouTubeTwitterFacebookLinkedInApp iTunes - Gradient CheckApp Google - Gradient CheckEuroHealthNet WebsiteEuropean Policies...European Commission (EC) is taking proactive measures to tackle the future challenges posed by an ageing population by prioritizing initiatives that will contribute to building a healthy and active population for...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 25 ] ciocd  
Updated: (May 4, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...for OCD and related disorders through the lifespan(pediatric, youth, and adult) representing 14 nations...we now know as OCD since the ... of 4 years old. We started seeing “specialists” when he was about 5 years old. Many wrong diagnostics later, he was diagnosed with severe OCD at ... 12. He is now 14 years old...
MeSH:
[ 26 ] CCMBL Database  
Updated: (Sep 18, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...LabAnnouncements Comparative Cellular and Molecular Biology of Longevity (CCMBL) DatabaseThe CCMBL database contains a wide range of cellular and molecular trait data from vertebrate species that has been collected by comparative biologists with the goal of identifying traits that are highly correlated with longevity. Currently the CCMBL database contains about a...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 27 ] ProteomeXchange Dataset  
Updated: (Jul 21, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...processes such as cellular metabolism, apoptosis, cellular senescence, cell cycle, and organism-level aging. Among the members of sirtuins showing different...and SIRT7: Implication of functional links to aging. Proteomics, 14(13-14):1610-22(2014...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 28 ] Page Not Found | sgim.org  
Updated: (Jul 19, 2011)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Obesity Now the Leading Cause of Shorter Lifespan, Beats Diabetes and SmokingRead More Meet our...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 29 ] Wheat protein database  
Updated: (Oct 24, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Mature Flag LeafObserved in Seedling RootObserved in Senescing LeafObserved in Mature RootsObserved in PericarpObserved in...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 30 ] IDAC idac – site  
Updated: (Jan 9, 2003)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...site      IDAC's Global AffiliationsIDAC's Global AffiliationsJapan's Center for Smart Aging ResearchIDAC: Japan's Center for Smart Aging ResearchRyuta KawashimaDirector, IDAC"LIVE TO RIDE and RIDE TO...CLOSEAbout UsGreeting & MissionNotable AlumniHistory of IDACResearch Facilities & FacultyResearch FacilitiesCommon FacilitiesResources & EquipmentBrain ImagingCell CenterEquipmentIDAC DATABASENEWS & EVENTSSmart Aging Research Center (S.A.R.C.)Admission & CoursesMaps & DirectionsGive to IDACContact UsMy IDACALUMNIJAPANESE CLOSEGreeting & MissionHealth and Longevity through SMART-AGING.IDAC is Japan's Center for Smart-Aging Research. We are a unique institute that is part of Tohoku University and we are affiliated with other national universities that also promote aging sciences.   It is a well-known fact that Japan’s population is aging...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[Immune dysfunctions in Fc receptor-deficient mice]   Paper Page   (Dec, 2002)  
[ 31 ] Cognitive Training Data  
Updated: (Oct 4, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Response LetterCognitive Training Data SignatoriesStanford Center on Longevity LetterStanford Center on Longevity Letter SignatoriesEvaluation CriteriaOur Self-evaluationPublished PapersAboutContactWhen it...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 32 ] Genes & Development  
Updated: (Dec 27, 2002)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...deletion of enhancers during neurodevelopmentRegenerating muscle cells, senescence, and DNA damage responses—Request a...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 33 ] Academy on Violence and Abuse|AVA|ACE Study|Violence|Abuse|Education|Research|Resources  
Updated: (Sep 23, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Document Online Now A Link Across the Lifespan Animal Abuse as a Marker for Traumatic...effects of violence and abuse across the lifespan.The vision of the AVA is that the recognition, treatment, and prevention of the health effects of violence and abuse are fully integrated into healthcare and society so that people of all ages are safe and healthy. Affinity GroupsAVA Affinity...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 34 ] Highest Quality Vitamins And Supplements - Life Extension  
Updated: (Sep 6, 2002)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Support Kidney & Bladder Support Liver Health & Detoxification Longevity & Wellness Men's Health Mood & Stress Management Sleep...how to reduce heart disease, slow the aging process, or prevent brain aging, Life Extension® reports it first.Subscribe TodayLearn...in your inbox weekly! Sign Up Anti-Aging News Newsletter ArchiveDaily NewsWhat's HotEventsBlog Media MultimediaPublic...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[Prevention and complementary medicine in aging]   Paper Page   (Jul, 2002)  
[ 35 ] 11  
Updated: (Aug 23, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...planning.Methods1. A survey of a national sample of 10% of the RNs of working ... (3,200 nurses). 2. Analysis of administrative data from the Ministry of Health' Nursing Division...characteristics and distribution by clinical field or economic sector, the percentage leaving work and the lifespan of full- or half-time work. This has hampered the assessment of the existing nursing...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Israeli registered nurse workforce.   Paper Page   (2012)  
[ 36 ] A. aegypti (Aedes aegypti) Genome Browser Gateway  
Updated: (Sep 10, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...unprecedented high resolution map of the developmental lifespan of A. aegypti by sequencing 34 unique...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 37 ] Registro Brasileiro de Ensaios Clínicos  
Updated: (Oct 17, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...o procedimento.enIntervention study : assessment of the longevity of restorations and sealants placed using the...implementation, with the objective of verifying its longevity. Control intervention: assessing the longevity of restorations and sealants placed using the...implementation, with the objective of verifying its longevity. The results for both groups will be...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 38 ] Small hive beetles survive in honeybee prisons by behavioural mimicry | SpringerLink  
Updated: (Sep 9, 2002)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...plant resins and continually guard them. The longevity of incarcerated beetles greatly exceeds their metabolic...Springer Nature © 2017 Springer International Publishing AG. Part of Springer Nature.Not logged in...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 39 ] Grandparenting.org  
Updated: (Jun 18, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...it today! Welcome Greetings, grandparents of all ages. Breaking News:Problems between parents and grandparents seem to be on the increase. Let us know if you are seeing the same in your world.Have you noticed any change in the grandparent visitation laws in your state lately? If so, let us know.Seems that longevity is re-shaping grandparenthood.  Many healthy...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 40 ] Welcome to FOXODB  
Updated: (Jul 20, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Y.H. Li, G.G. Zhang, Towards understanding the lifespan extension by reduced insulin signaling: bioinformatics analysis...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 41 ] e-BDporc  
Updated: (Jun 11, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Markov decision sow model representing the productive lifespan of herd sows. Agric. Sys. 76:253...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 42 ] WHO | World Health Organization  
Updated: (May 4, 2009)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Dental care and oral health for healthy longevity Word Congress 2015At the end of World Congress 2015, the Tokyo Declaration on Dental care and oral health for healthy longevity was adopted to call upon health policy...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 43 ] Welcome to PvGEA Atlas  
Updated: (Oct 11, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...collected 1 to 4 days after floral senescence. Samples contain developing embryos at globular stagePH...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 44 ] ?doi=451053  
Updated: (Nov 15, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...com/?doi=451053.© 2016 S. Karger AG, BaselKeywordsAcute kidney injury · Renal replacement therapy...were predominantly (90%) male, with a mean ... of 60.2 (range 25-86). The...in the CVVHD-RCA mode). Circuit LifespanCircuit lifespan data are presented in figure 2. Overall...h. Fig. 2Survival curves for circuit lifespan. Reasons for Therapy InterruptionTherapy interruption was related...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 45 ] Home - Enzo Life Sciences  
Updated: (Mar 27, 2003)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...the fight against cancer?A Peptide Targeting Senescent Cells Can Reverse AgingWhat are the differences...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 46 ] Welcome to ielsg  
Updated: (Aug 21, 2007)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...leather breitling replica uk will probably have longevity. This cased characters should likewise be manufactured...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 47 ] Network Search | Causal Bio Network  
Updated: (Apr 18, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...for DNA Damage, Autophagy, Cell Death, and Senescence. Bioinformatics and Biology Insights 7: 97-117...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 48 ] Plant Expression Database  
Updated: (Feb 21, 2008)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Carbohydrate accumulation in barley leaves leads to senescence and protease g...BB52:Transcriptome analysis of...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
BarleyBase/PLEXdb.   Paper Page   (2007)  
[ 49 ] WebCite query result  
Updated: (Jun 29, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...than at any other stage in the lifespan. Despite the availability of effective treatments for...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 50 ] 20  
Updated: (May 5, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...life processes, from development through metabolism to senescence, aging and death (reviewed in [1]).While animals...for long-term functional assays, such as aging assays, where the miRNA in question needs...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 51 ] Bat Genome Database: A database of Bat Genome  
Updated: (Jun 26, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Genome analysis reveals insights into physiology and longevity of the Brandt's bat Myotis brandtii. Nature...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 52 ] Siggia ‘Lab’ Rockefeller Univ.  
Updated: (Oct 29, 2003)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Can anyone name a volume of comparable longevity for the practicing scientist?)  My contemporaries...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 53 ] The ubiquitination site  
Updated: (Feb 9, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...in plants. Besides regulation of the protein longevity via targeted degradation by the ubiquitin proteasome...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 54 ] Single Port Laparoscopy - Fertility Sterility Discussion  
Updated: (Apr 30, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Effect? Journal Club Live July 2013Male Rejuvenation: Longevity Science or Dangerous Hype?- Journal Club LiveMay...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Single port laparoscopy.   Paper Page   (May, 2012)  
[ 55 ] Chromosomal Transfer in Mature Oocytes - Fertility Sterility Discussion  
Updated: (Apr 30, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Effect? Journal Club Live July 2013Male Rejuvenation: Longevity Science or Dangerous Hype?- Journal Club LiveMay...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Chromosome transfer in mature oocytes.   Paper Page   (May, 2012)  
[ 56 ] Anschutz Aurora & Denver Based Community Wellness Programs  
Updated: (Apr 11, 2005)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...disease progression, restore motor function, and increase longevity and quality of life.PWR! Circuit classes...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Action on obesity: report of a mayo clinic national summit.   Paper Page   (Apr, 2005)  
[ 57 ] Standardization of laparoscopic pelvic examination - Fertility Sterility Discussion  
Updated: (Apr 1, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Effect? Journal Club Live July 2013Male Rejuvenation: Longevity Science or Dangerous Hype?- Journal Club LiveMay...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Standardization of laparoscopic pelvic examination.   Paper Page   (Apr, 2013)  
[ 58 ] index  
Updated: (Sep 29, 2005)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...those with a giant nevus over the ... of 16. E-mail us for more...class?" For lots more information and practical, ...-appropriate techniques on handling stares, questions, and...medicine, length of time used, frequency, and ..., with babies/infants seeming to be at...AND HEALTH AND WELL-BEING OVER THE LIFESPAN Contrary to popular myth, children are NOT...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 59 ] m:Explorer -- multinomial regression models of transcriptional regulation  
Updated: (Sep 14, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...models reveal positive and negative regulators of longevity in yeast quiescence (2012) Genome Biol 13...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 60 ] 17482968.2011.590992  
Updated: (Oct 10, 2011)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...post-mitotically, given that ALS is an ...-related disease.Meeting report of the International...in SOD1-G93A rat model– Short lifespan of SOD1-G93A rats versus long maturation...
MeSH:
[ 61 ] Welcome to Toxipedia - Toxipedia  
Updated: (Jan 22, 2009)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Forward#19: Linus Pauling, Scientist for the Ages"It is sometimes said that science has...multiple environments influence our health across the lifespan.The stories are accessible to an educated...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 62 ] s13059-015-0714-1  
Updated: (Jul 11, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...C. elegans and mammalian systems. The short lifespan of C. elegans allows the survival of...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 63 ] OrthoMaM project  
Updated: (Jun 26, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...61. A new method for estimating species ... supports the coexistence of malaria parasites and...-971, 2012.28. A method to find longevity-selected positions in the mammalian proteome. J....2010.09. An evolutionary genome scan for longevity-related natural selection in mammals. R. W....
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 64 ] Duplicate regions on chromosomes 4 and 8  
Updated: (Jan 24, 2008)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...39. Tb927.4.4740/Tb927.8.7730 longevity-assurance protein 40. Tb927.4.4730/Tb927...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 65 ] abstract  
Updated: (May 28, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Paolo Spallarossa, 5-fluorouracil causes endothelial cell senescence: potential protective role of glucagon-like peptide...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 66 ] tisei.org  
Updated: (Apr 24, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...compaction. Compaction is the key to the longevity of your new driveway. www.dumpsterrentalpassaicnj.comwww...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 67 ] Pro Hair Loss Insight & Modern Education - Phime.org  
Updated: (Feb 14, 2011)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...growth for each follicle. In theory, the longevity of the hair staying in the anagen...of men will experience MPB by the ... of 30, and 2/3 begin balding by the ... of 60. Research also indicates that men...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 68 ] bird-tracking-gull-occurrences  
Updated: (Feb 15, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...mass), life history data (day of ringing, ..., resightings by volunteers), as well as growth...GPS tracker no longer functions (typical tracker lifespan: 2-3 years). Bibliographic Citations Stienen EWM...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 69 ] 17  
Updated: (Aug 23, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...estimated as were additional costs due to increased longevity of program participants. Data on costs and QALYs...A program directed at the entire Israeli population aged 20 and over, using a variety of eight...BMI levels.The BMI prevalence distribution for adults aged 20 and above [Personal Communication, Dr Tami Shohat, Israel Centre for Disease Control] was multiplied by the total adult population aged 20 and above in 2010 of 4,835...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 70 ] 1471-2105-8-410-S1  
Updated: (Feb 13, 2008)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...A-3mer3[-40,-20] www.spliceport.org Found 346 features in this interval -------------ctgacc--||AG 0.179837 ------------ctgacc---||AG 0.167811 -----------ctgacc----||AG 0.145336 --------------cctgac-||AG 0.141731 ---------ctgacc------||AG 0.136983 -------ctgacc--------||AG 0.135907 ---------------ctgacc||AG 0.135844 --------------ctcacc-||AG 0.125415 ------------ctcacc---||AG 0.121931 ------------cctgac---||AG 0.120181 ---------ccctga------||AG 0.118673 --------------taactg-||AG 0.118501 --------------tctgac-||AG 0.118146 ------------taactt---||AG 0.115586 -----------gctgac----||AG 0.113899 --------ctgact-------||AG 0.112664 -------------cctgac...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 71 ] 1207  
Updated: (Mar 21, 2001)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...the mdx/utr−/− mice extended their longevity by threefold, reduced kyphosis and the development of muscle...and die prematurely between 4 and 20 wk of ... (Deconinck et al. 1997b; Grady et al. 1997b).To...of the α7BX2 chain isoform show greatly improved longevity and mobility compared with nontransgenic mdx/utr−/â...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 72 ] Helmholtz Allianz Preclinical Comprehensive Cancer Center - PCCC  
Updated: (Sep 3, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...and CancerGenetic EpidemiologyStaffSoftwareMolecular Genetic EpidemiologyStaffProjectsPublicationsToolsEUNAMClinical Epidemiology and Aging ResearchProjectsStaffPublicationsAnnouncementsOpeningsBiostatisticsStaffBiostatistical Service and Support Statistics CoursesResearchPredictive modelingClinical...MortalityComparison with Other Causes of DeathTrendsOverviewOverview by ... rangeInternational ComparisonSurvival RatesCancer IncidenceLeading Causes of Cancer...and CancerGenetic EpidemiologyStaffSoftwareMolecular Genetic EpidemiologyStaffProjectsPublicationsToolsEUNAMClinical Epidemiology and Aging ResearchProjectsStaffPublicationsAnnouncementsOpeningsBiostatisticsStaffBiostatistical Service and Support Statistics CoursesResearchPredictive modelingClinical...MortalityComparison with Other Causes of DeathTrendsOverviewOverview by ... rangeInternational ComparisonSurvival RatesCancer IncidenceLeading Causes of Cancer...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 73 ] Blood lipids influence DNA methylation in circulating cells | Genome Biology | Full Text  
Updated: (Jul 15, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...and women (32–60 % men) and the ... of the individuals ranged from 18 to 81...Diabetes and Atherosclerosis Maastricht, LL LifeLines, LLS Leiden Longevity Study, NTR Netherlands Twin Register, PAN Prospective ALS...Atherosclerosis Maastricht (CODAM) [33], LifeLines (LL) [34], Leiden Longevity Study (LLS) [35], the Netherlands Twin Register (NTR...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 74 ] Membrane domain organization of myelinated axons requires βII spectrin | JCB  
Updated: (Nov 12, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...controls. However, starting at two weeks of ..., cKO mice exhibited significant hind leg clasping...strength at 2 and 4 mo of .... Avil-Cre;SPNB2f/f mice have significantly...muscle strength, we observed that at all ages the cKO mice had significantly reduced grip...3 A, arrow). By two weeks of ... in control mice, fewer than 20% of...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Axonal spectrins: All-purpose fences.   Paper Page   (Nov 11, 2013)  
[ 75 ] Discs of mammalian rod photoreceptors form through the membrane evagination mechanism | JCB  
Updated: (Nov 10, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...continuous renewal throughout the animal’s lifespan, with new membranes added at the outer...Expression of human complement factor H prevents ...-related macular degeneration-like retina damage and kidney abnormalities in aged Cfh knockout mice. Am. J. Pathol. 185...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 76 ] UCL Institute of Health Equity - IHE  
Updated: (Apr 14, 2011)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...12 years before someone of the same ... in Swansea west Call for change to...Panorama, discussing AmazonHealth Study Highlights Minority InequalitiesShorter lifespans among poor costing Europe trillionsCNN Opinion Piece...ready to start school'Half of English pupils aged five 'are not ready for school when...resilienceSocial Determinants of Health and the Working-... Population: Global Challenges and Priorities for ActionUK...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 77 ] s12916-016-0621-7  
Updated: (Jun 18, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...gametocytaemia by microscopy at enrolment was 12.1 % (5887/48,589), and increased with decreasing ..., decreasing asexual parasite density and decreasing haemoglobin concentration, and was higher in patients without fever...treatment, gametocytes may persist for several weeks after the clearance of asexual parasites with their longevity and infectivity depending on the treatment dispensed [8, 9], dosing [10] and host immunity [5...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 78 ] jcb.201211160  
Updated: (May 14, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...adaptation to stress, starvation, and protection from aging, cancer, neurodegeneration, and invading pathogens (Mizushima et...Syx17 mutant brains (B) compared with similarly aged controls (A). (C–E) No autophagosomes...Syx17 in mutant brains, unlike in similarly aged controls (Fig. S2, D–F). TUNEL...autophagy promotes neuronal health, stress tolerance, and longevity but is dispensable for metamorphosis in Drosophila...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Route to destruction: Autophagosomes SNARE lysosomes.   Paper Page   (May 13, 2013)  
[ 79 ] Disease Discovery  
Updated: (Aug 22, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...intraarticular calcificationCafe-au-lait spotBuphthalmosBulimia/hyperphagiaBuild/stature/longevity anomaliesBrushfield spotsBruisabilityBronchogenic cystBronchiolitisBronchial dilation/dilatation/bronchiectasiaBroad/bifid...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 80 ] Cancer Proteomics Database  
Updated: (Feb 7, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...DNA damage, mitotic stress, genomic instability, apoptosis, senescence, growth signalling, angiogenesis, inflammation and infection play...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 81 ] Cancer Proteomics Database  
Updated: (Jan 15, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...DNA damage, mitotic stress, genomic instability, apoptosis, senescence, growth signalling, angiogenesis, inflammation and infection play...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 82 ] Cancer Proteomics Database  
Updated: (May 3, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...DNA damage, mitotic stress, genomic instability, apoptosis, senescence, growth signalling, angiogenesis, inflammation and infection play...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 83 ] RNASeqMetaDB  
Updated: (Dec 15, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...their activationFoxp3Noneregulatory T-lymphocyteE-GEOD-57396An aging-like phenotype occurs in Tif1γ-/- hematopoietic stem...alpha Het) to elucidate the effect of senescence in mouse colorectal tumorCsnk1a1, Trp53, Cdkn1aColorectal NeoplasmsenterocyteE...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 84 ] International Society for the Study of the Aging Male(ISSAM)  
Updated: (Nov 21, 2003)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...charset=us-ascii International Society for the Study of the Aging Male(ISSAM)About ISSAMExecutive CouncilObjectivesRationalStrategic IntentMembershipApplication for 2017 membershipRenewal for 2017 membershipUpdate form Sponsor & Affiliation CriteriaCo-Sponsor CriteraAffiliation CriteraEndorsement CriteraTools & ServicesFree & Bioavailable Testosterone calculatorThe aging males' symptoms (AMS) rating scaleLate-onset HypogonadismAlliance for Aging ResearchSelected ISSAM presentations at 5th World Congress of the Aging MaleSelected ISSAM presentations at 4th World Congress of the Aging...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Testosterone supplementation: why and for whom?   Paper Page   (Sep, 2003)  
[ 85 ] Welcome to the Digital Ageing Atlas, the portal of ageing related changes | The Digital Ageing Atlas  
Updated: (Jan 16, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
25232097 http://ageing-map.org/ text/html; charset=us-ascii Welcome to the Digital Ageing Atlas, the portal of ageing related changes | The Digital Ageing AtlasThe Digital Ageing AtlasNavigationAboutHelpDownloadsContact or contributeSearch Human MouseSearchUse anatomical modelWelcome to the Digital Ageing Atlas, the portal of ageing-related changesThe Digital Ageing Atlas (DAA) is a portal of age-related...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 86 ] jcb.201506065  
Updated: (Jan 5, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Cbx4 protein protects epithelial stem cells from senescence through PRC-dependent repression of the Ink4a...At E16.5, the appearance of the senescence-associated marker γ-H2AX was seen in...expression of the cell cycle inhibitor genes (senescence-linked Ink4a locus p16/p19 and Cdkn1c...ns, not significant.Given that Cbx4 suppresses senescence in human epidermal KCs (Luis et al., 2011), we examined the mechanisms underlying the Cbx4-dependent regulation of the senescence-linked cell cycle inhibitor genes and performed...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 87 ] Home || Aging Life Care Association  
Updated: (Aug 26, 2003)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
12938251 http://www.aginglifecare.org/ text/html; charset=utf-8 Home || Aging Life Care Association Skip to main content Loading ALCA LOGOFind an Aging Life Care CoachToggle navigation HomeAbout UsEventsContactMember ResourcesSign InALCA LOGOFormerly National Association of Professional Geriatric Care ManagersFacebookTwitterLinkedInYoutubeKeyword SearchFind an Aging Life Care CoachAbout Aging Life CareToggleWhat you need to knowSelecting an Aging Life Care ProfessionalWorking with an Aging Life Care ProfessionalCertification and Professional ConductALCA BlogALCA Consumer LibraryVideo LibraryConsumer ResourcesFind an Aging Life Care...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 88 ] WHO | Proposed working definition of an older person in Africa for the MDS Project  
Updated: (Jul 16, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...developed in 2002 to define the scope of the Project on Minimum Data Set for Ageing in Africa. For further information on ageing and WHO’s current strategy on Ageing and Health, please visit the WHO web pages on ageing and life-course.Most developed world countries have accepted the chronological ... of 65 years as a definition of 'elderly' or older person, but like many westernized...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Integration of RFID and Web Service for Assisted Living.   Paper Page   (Aug, 2012)  
[ 89 ] Flinders Centre for Ageing Studies  
Updated: (Dec 3, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...html; charset=us-ascii Flinders Centre for Ageing StudiesStudyResearchEngageAlumniAboutQuick links Current students Staff Library Student Two - Staff Flinders dashboard (Okta) Flinders Learning Online (FLO) Campus map: Bedford Park Staff directory Jobs at Flinderspowered bySection navigationFlinders Centre for Ageing StudiesHomeHistoryALSAStaff & AffiliatesResearch Projects and ActivitiesCommunity presentationsAgeing Seminar...Behavioural Sciences  > Flinders Centre for Ageing Studies Flinders Centre for Ageing Studies The Flinders Centre for Ageing Studies (FCAS) has a multidisciplinary focus on...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 90 ] The Survey of Health, Ageing and Retirement in Europe (SHARE): Home  
Updated: (Aug 22, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...charset=utf-8 The Survey of Health, Ageing and Retirement in Europe (SHARE): Home______________ SHARE - Survey of Health, Ageing and Retirement in Europe - Survey of Health, Ageing and Retirement in Europe HomeOrganisation›Dates & FactsSHARE...are here: HomeSHARE - Survey of Health, Ageing and Retirement in EuropeThe Survey of Health, Ageing and Retirement in Europe (SHARE) is a...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 91 ] s12915-016-0296-8  
Updated: (Sep 20, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...type strains are shown. c Study of longevity of the sexing strains at standard and cooler temperatures. Longevity at 25 Â°C (dark curves) and 19 Â°C (light curves) of males from the J06 parental strain, the FL12-56 and FL11-15 transgenic lines. Two replicates of longevity tests with 50 males were combined and...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 92 ] AG-Epilepsiechirurgie: Übersicht  
Updated: (Jun 24, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
24861193 http://www.ag-epilepsiechirurgie.de/ text/html; charset=unknown-8bit AG-Epilepsiechirurgie: ÜbersichtAG-EpilepsiechirurgieArbeitsgemeinschaft für prächirurgische Diagnostik und...Sie befinden sich auf der Seite der AG - EpilepsiechirurgieSponsored by:Ausserordentliche Mitglieder (Fördermitglieder):Andere Förderungen:Förderung der Minifellowships der AG, 1. Kohorte durch:UCB Pharma GmbH DeutschlandAktuellesEs sind jetzt die AG-Epilepsiechirurgie Anstecker verfügbar! Näheres unter AktuellesCopyright © 2017 AG-EpilepsiechirurgieDesign by Marcus Belke | Powered by TYPO3...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 93 ] Home | ShARM  
Updated: (Dec 3, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...resources to accelerate research into ageingMain menuGet Aged MiceProvide Aged MiceWelfareJoin the ShARM CommunityFAQAbout UsContact UsShARM is a not for profit organisation, open to all scientific investigators in the UK and overseas, aiming to accelerate research into ageing by facilitating the sharing of resources. ShARM provides immediate and cost effective access to aged murine models and their tissues, and promotes...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 94 ] s12915-016-0319-5  
Updated: (Nov 19, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...cytoplasmic incompatibility) who have passed the minimum ... for the first oviposition (T G ; Additional...supporting dataData from field-cage experiments: mosquito ...-class abundances and Wolbachia infection frequencies, and...Moyes CL, Drake JM, Brownstein JS, Hoen AG, Sankoh O, et al. The global distribution...ArticlePubMedPubMed CentralGoogle ScholarHancock PA, White VL, Callahan AG, Godfray HCJ, Hoffmann AA, Ritchie SA. Density...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 95 ] AGE download page  
Updated: (Feb 22, 2011)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
21233167 http://sv.gersteinlab.org/.../ text/html; charset=us-ascii ... download page By downloading ... software you agree to the terms of Creative Commons license (Attribution-NonCommerical). Download: ... v0.4; September 12, 2011 Added functionality to align sequences with inversions or tandem duplications. Improved search for alternative alignments.... v0.2AGE v0.1...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 96 ] FARA - Research Pipeline  
Updated: (Aug 28, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...-743 treated subjects when compared to an ..., sex and disease-severity matched natural history...ataxia. MOXIe is enrolling individuals with FA ages 16-40 years who are able to...study is now enrolling individuals with FA ages 10-50 years: link to post on...mitochondrial function and some studies suggest increased longevity, lowering glucose levels and anti-cancer activity...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
A review of friedreich ataxia clinical trial results.   Paper Page   (Sep, 2012)  
[ 97 ] jcb.201507042  
Updated: (Feb 2, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...2008. ATR signaling can drive cells into senescence in the absence of DNA breaks. Genes...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 98 ] ProteinHistorian: Protein Age Estimation and Enrichment Analysis  
Updated: (Jul 4, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...ProteinHistorian/ text/html; charset=us-ascii ProteinHistorian: Protein ... Estimation and Enrichment AnalysisProteinHistorian: Protein ... Estimation and Enrichment AnalysisProteinHistorian identifies enrichment for proteins of different phylogenetic ages in protein sets of interest. ProteinHistorian is to...can be uploaded to combine with the protein ... analysis. ProteinHistorian is described in the following paper: Capra JA, Williams AG, and Pollard KS. ProteinHistorian: Tools for the Comparative...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 99 ] 000356048  
Updated: (Feb 14, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...10.1159/000356048).© 2013 S. Karger AG, BaselKeywordsAnimal model · Ischemic stroke · 3...Bipolar coagulator (AESCULAP tb50; B. Braun Melsungen AG, Melsungen, Germany) • Micorforceps connected to the coagulator (GK690R, B. Braun Melsungen AG)• Bone rongeur for zygomatic...Microsurgery scissors (AESCULSP FD012R, B. Braun Melsungen AG) • Needle and a thread...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 100 ] 1471-2105-8-410-S2  
Updated: (Feb 13, 2008)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...in the set A-3mer1[-60,-5] at the end of the file. -----------------------ctga---------------------AG, 24, 0.178431 ---------------------------ctga-----------------AG, 20, 0.161183 --------------------------ctga------------------AG, 21, 0.161072 ------------------------ctga--------------------AG, 23, 0.153586 ----------------------ctga----------------------AG, 25, 0.142684 ---------------------ctga-----------------------AG, 26, 0.132723 --------------------ctga------------------------AG, 27, 0.126387 ----------------------------ctga----------------AG, 19, 0.119018 ------------------ctga--------------------------AG, 29, 0.0883748 -----------------ctga---------------------------AG, 30, 0.0610774 -----------------------ctaa---------------------AG, 24, 0.157934 --------------------ctaa------------------------AG, 27, 0.151807 ------------------------ctaa--------------------AG...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 101 ] Landon Center on Aging  
Updated: (Mar 9, 2001)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...http://www.kumc.edu/landon-center-on-aging.html text/html; charset=utf-8 Landon...Kansas HospitalLandon Center on AgingLandon Center on Aging SearchCenter HomeGeriatricsGeriatricsEducationClinicalDoctor PresentationsResearchTeachingCommunity Outreach ProgramsCommunity Outreach ProgramsBrownbag Lunch SeriesFamily Caregiver's Support GroupForever Young ChoirImages of Aging Photo ContestLandon Fitness CenterSpecial EventsResearchResearchHuman Performance LaboratoryGrayhawk...many other Midwestern states, has a growing aging population, with 493,000 persons over the ... of 65 expected in 2020 and 42,000 over the ... 85. As Baby Boomers continue to come...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 102 ] WHO | WHO Study on global AGEing and adult health (SAGE)  
Updated: (Jan 3, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...utf-8 WHO | WHO Study on global AGEing and adult health (SAGE)Skip to main...universal health coveragePublications WHO Study on global AGEing and adult health (SAGE) WHO's SAGE is a longitudinal study collecting data on adults aged 50 years and older, plus a smaller comparison sample of adults aged 18–49 years, from nationally representative...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 103 ] Nuclear envelope rupture is induced by actin-based nucleus confinement | JCB  
Updated: (Oct 4, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...8 s), our data suggest that the longevity of chromatin herniations correlates with the frequency...and R01NS096786), the Glenn Family Foundation for Aging Research, the NOMIS Stiftung, the American Cancer...Wilson. 2005. The nuclear lamina comes of .... Nat. Rev. Mol. Cell Biol. 6:21â...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 104 ] NAES - Nevada Agricultural Experiment Station, University of Nevada, Reno  
Updated: (Jan 26, 2005)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
15669290 http://www.ag.unr.edu/ text/html; charset=us-ascii...AreasList of ProjectsImpacts of ResearchResearch FundingFacilitiesPeoplePublicationsNewsCalendarResourcesCollege of Ag (CABNR)Subscribe to NewsletterVisit The CampusCooperative ExtensionContact UsNevada Ag Experiment Station Mail Stop 221 1664 N. Virginia Street Reno, NV 89557   Phone (775) 784-6237 Fax (775) 784-4227 Max Fleischmann Ag Bldg, Room 201Location/Directions     Feral...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 105 ] ProteomeXchange Dataset  
Updated: (Apr 24, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...dataRepositorySupport: Unsupported dataset by repositoryPrimarySubmitter: Kelly StauchTitle: Aging Mouse Brain Mitochondria LC-MS/MSDescription: This study investigates the proteomic alterations in brain mitochondria isolated from 5- (mature), 12- (old), and 24-month-old (aged) mice to examine normal "healthy" aging. Using quantitative mass-spectrometry based super-SILAC...potentially allow for compensatory mechanisms to combat aging.SpeciesList: scientific name: Mus musculus (Mouse); NCBI...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 106 ] AG Mednet — Improving Data Quality in Global Clinical Trials  
Updated: (Sep 20, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...agmednet.com/ text/html; charset=utf-8 AG Mednet — Improving Data Quality in...organizations and principal investigators. Read More...SupportThe AG Mednet Global Help Desk is available 24x7x365 to support users around the globe. Our call center fields the call, initiates the troubleshooting, and assigns an AG Mednet technical resource. Read More...Download our...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 107 ] Home - Cell Symposia Aging and Metabolism  
Updated: (Jun 16, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
27304491 http://www.cell-symposia-aging-metabolism.com/ text/html; charset=utf-8 Home - Cell Symposia Aging and Metabolism   Cell Symposia Home Cell...out the conference app here » The word "aging" encompasses a range of physiological changes in...processes that ultimately decline or shift during aging. The recent wealth of information on how perturbation of metabolic factors can accelerate or impair aging processes makes this an exciting time to...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 108 ] jcb.201601014  
Updated: (Aug 16, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...important for maintaining synapse integrity over the lifespan. We tested for differential expression of Drosophila...M. Hammarlund. 2014. Insulin/IGF1 signaling inhibits ...-dependent axon regeneration. Neuron. 81:561â€...KIF1A is a key regulator of synaptic aging and insulin signaling-regulated memory. Curr. Biol...02.017OpenUrlCrossRefPubMed↵O’Neill, L.A.J., and A.G. Bowie. 2007. The family of five: TIR...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 109 ] 46  
Updated: (Jun 14, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...into the fermentable glucose is hampered. The senesced inflorescence stems of a set of 20...lignin, cellulose, and matrix polysaccharides) of the senesced inflorescence stems of Arabidopsis mutants, mutated in...the final height and weight of the senesced inflorescence stems of the mutants with those...measured by the weight of the primary senesced inflorescence stem (without rosette leaves, axillary inflorescences...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 110 ] Gen Silent — The LGBT Aging Film  
Updated: (May 24, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...-8 Gen Silent — The LGBT Aging FilmGen SilentThe LGBT Aging FilmAboutAboutThe FilmmakersAcclaim for the FilmThe PeoplePast ScreeningsFAQsLGBT Aging ResourcesPurchasePurchaseTerms of UseTools for your screeningPress KitContactContact...most real film I have seen about aging -- period. Gen Silent reminds us of our...of people are fighting to keep LGBT aging from meaning aging in silence.Read MoreAbout the FilmmakerStu is...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 111 ] WebCite query result  
Updated: (Jun 9, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...charset=us-ascii Physical Activity, Sleep and ... - Full Text View - ClinicalTrials.govSkip to Main...smallerResetcloseHomeFind StudiesStudy Record DetailPhysical Activity, Sleep and ... This study has been completed. Sponsor: Maastricht...to assess relations between these indexes and ...;Intervention study to assess the effect of exercise training on daily life movement efficiency and quality of sleep in ageing subjects45 healthy human volunteers, ... 50-83 yr, BMI 20-30 kg...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 112 ] ISRCTN30189842  
Updated: (Mar 28, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Intervention Infants will be enrolled at term equivalent ... and will be prospectively followed-up from term to 12 months of corrected ....At term equivalent ... infants will be randomised in four groups:Group 1: infants born average for gestational ... (AGA) fed nutrient-enriched post-discharge formula (2....
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 113 ] A matrix metalloproteinase mediates long-distance attenuation of stem cell proliferation | JCB  
Updated: (Sep 30, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...ratios to the progeny classes; however, the lifespan, fertility, and follicle cell phenotypes of adult...were collected every 2 d upon eclosion, aged at 29°C for 5 d, exposed...d upon eclosion to 29°C, and aged 7–10 d before dissection. For...scored. Stem cell clones were identified by aging the flies for 7 d after clone...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 114 ] QUT | Working with Older People | Home  
Updated: (Jul 14, 2008)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...will show you many interesting aspects of ageing and introduce you to some of the...keeps him fit and active at the ... of 84. He has fair skin and little head hair. What could you be investigating to assess Jack's health status?Read more about The Orchid Man storyWhat’s covered in the modulesActive Ageing & Health Promotion Older Persons in the Acute...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 115 ] 404 Error - Nevada Agricultural Experiment Station, University of Nevada, Reno  
Updated: (Sep 5, 2001)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...AreasList of ProjectsImpacts of ResearchResearch FundingFacilitiesPeoplePublicationsNewsCalendarResourcesCollege of Ag (CABNR)Subscribe to NewsletterVisit The CampusCooperative ExtensionContact UsNevada Ag Experiment Station Mail Stop 221 1664 N. Virginia Street Reno, NV 89557   Phone (775) 784-6237 Fax (775) 784-4227 Max Fleischmann Ag Bldg, Room 201Location/Directions  Page Not...-6237 Fax (775) 784-4227 Max Fleischmann Ag, Room 201Location/DirectionsNevada Agricultural Experiment Station Mail...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 116 ] www.kamick.org  
Updated: (Apr 3, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Models for predicting the adult height and ... at first menstruation of girls with idiopathic central precocious pubertyModels for predicting the adult height and ... at first menstruation of girls with idiopathic central precocious pubertyThe formula below is based on the work:Models for predicting the adult height and ... at first menstruation of girls with idiopathic...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 117 ] AJP-Heart and Circulatory Podcasts » Aging Impairs Endothelial Ca2+ Signaling  
Updated: (May 20, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
26945073 http://ajpheart.podbean.com/e/aging-impairs-endothelial-ca2-signaling/ text/html; charset=utf-8 AJP-Heart and Circulatory Podcasts » Aging Impairs Endothelial Ca2+ SignalingAJP-Heart and Circulatory...2016 — khkeehan We know that as we ..., blood vessels become less effective at getting...smooth muscle cells of microvessels contribute to aging-related vascular dysfunction? Listen as Guest Editor...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 118 ] EXAMINER | UCSF Memory and Aging Center  
Updated: (Jun 11, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...charset=utf-8 EXAMINER | UCSF Memory and Aging CenterUCSFUniversity of California, San FranciscoAbout UCSFUCSF Medical CenterUCSF Memory and Aging CenterEspanolChineseUCSF Memory and Aging CenterEducationPatient CareCaregiving & SupportResearch & Clinical TrialsOur CenterResource SharingDonate to the UCSF Memory and Aging CenterSearch this site: BlogYouTubeTwitterFacebookGet EmailEXAMINERCohortsBiospecimensBrain BankDataTechnologyVideoEXAMINERBackgroundExecutive functioning...is adaptable across a wide range of ages and disorders.Read MoreProject StructureEXAMINER was developed...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 119 ] PML isoform II plays a critical role in nuclear lipid droplet formation | JCB  
Updated: (Jan 5, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...been ascribed, including transcriptional regulation and cellular senescence. The PML NB core is made of...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 120 ] MetaSV  
Updated: (Aug 8, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...SV breakpoints using assembled contigs. Please compile ... without OpenMP support using make OMP=no...bam alignments.bam --spades SPAdes/spades.py --age AGE/age_align --num_threads 15 --workdir work --outdir...bam alignments.bam --spades SPAdes/spades.py --age AGE/age_align --num_threads 15 --workdir work --outdir...bam alignments.bam --spades SPAdes/spades.py --age AGE/age_align --num_threads 15 --workdir work --outdir...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 121 ] H1237.long  
Updated: (Dec 2, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...no obvious pathology at 9 mo of ..., indicating full regeneration. Utilizing the same assays...siRNA-mediated knockdown in rat neonatal cardiomyocytes (... is unclear) increased rates of histone H3...suggested that cardiomyocyte proliferation markedly decreased with .... Considering that the use of αMHC...efficiency of mammalian cardiomyocytes decreases dramatically with ..., which might be at least in part...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 122 ] Working Longer Group - NHS Employers  
Updated: (Nov 27, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...workforce working to a later, raised retirement .... It was a partnership group of national...implications of working to a raised retirement ....  We have also produced a range of tools and resources to assist employers and employees. Our tools and resources include:The ... awareness toolkit â€“ helping organisations assess and action plan their readiness for the opportunities and challenges of an ageing workforce.Improving your understanding of the NHS...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 123 ] WebCite query result  
Updated: (Dec 20, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...an online access panel 2. In the ages between 15 and 20 years, either sex...moderate drinking. The advice for young adults aged 18 - 20 years is in line with the guidelines of the Dutch National Health Council recommending that men should not drink more than 2 glasses alcohol per day and women 1 glass alcohol per day (Dutch National Health Council, 2009). Adolescents under the ... of 16 receive advice to abstain from...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 124 ] Home | AgEBB  
Updated: (Nov 21, 2002)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...NetworkUniversity of Missouri Extension Regional NewslettersNorthest Region Ag ConnectionSoutheast Region and East Central Missouri Ag NewsNorthwest Region News You Can UseSouthwest Region Southwest Missouri NewsWest Central Region Ag in FocusCrop and Plant ResourcesCottonHorticultureIntegrated Pest ManagementMissouri...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Swine fever: classical swine fever and African swine fever.   Paper Page   (Nov, 2002)  
[ 125 ] RRE-90  
Updated: (Jan 12, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...different circulations Yes NoMultiple infarcts of different ages Yes NoIsolated cortical infarcts Yes NoCCS etiologic...Schwamm LH, Furie KL, Koroshetz WJ, Sorensen AG. A score to predict early risk of recurrence after ischemic stroke. Neurology. 2010 Jan 12;74(2):128-35 (PubMed abstract).Ay H, Benner T, Arsava EM, Furie KL, Singhal AB, Jensen MB, Ayata C, Towfighi A, Smith EE, Chong JY, Koroshetz WJ, Sorensen AG. A Computerized Algorithm for Etiologic Classification of...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 126 ] Molecular Diversity Preservation International (MDPI)  
Updated: (Sep 24, 2004)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...at www.mdpi.com. May 2010: MDPI AG was founded where MDPI stands for Multidisciplinary...net. This was taken over by MDPI AG. © 1996-2013 Molecular Diversity Preservation International (MDPI), Basel, Switzerland (http://www.mdpi.org) Since 2013, maintained by MDPI AG (http://www.mdpi.com) Last change: 26...
MeSH:
[ 127 ] WHO | WHO Anthro (version 3.2.2, January 2011) and macros  
Updated: (Jun 2, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...the attained growth standards (length/height-for-..., weight-for-..., weight-for-length, weight-for-height, body mass index-for-..., head circumference-for-..., arm circumference-for-..., triceps skinfold-for-... and subscapular skinfold-for-...). Download Rzip, 506kbRead mepdf, 200kbDownload SPSSzip, 554kbRead...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 128 ] National Trauma Institute  
Updated: (Feb 18, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Because trauma is a disease affecting all ages of people, the impact on life years...     #1 for ... group 1-46, or 47% of all deaths in this ... range       #3 as leading cause of death overall, across all ... groupsBurns4 (2013, most recent available)  ...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 129 ] Australian Institute of Health and Welfare  
Updated: (Jan 28, 2003)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Public Interest Disclosure Tenders  SubjectsBy category Ageing, disability & carers Families & children Hospitals Housing & homelessness Indigenous Australians Population groups Risk factors, diseases & death Services, workforce & spendingBy subject Adoptions Aged care Ageing Alcohol & other drugs Arthritis & musculoskeletal conditions Asthma...to release notices  By subject Adoptions Aged care Ageing Alcohol & other drugs AIHW annual reports Arthritis...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
The Australian Institute of Health and Welfare.   Paper Page   (2002)  
[ 130 ] 4D neonatal head models  
Updated: (Aug 18, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...standard atlas model that provides the necessary, ...-matched models of the brain and extra-cerebral tissues for pre-term and term ... infants that are necessary for accurate use...from 324 infants (160 female) between the ages of 27 and 47 weeks (post-menstrual ...).The infant head models available below will...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 131 ] MEIERHOFER AG - MCC. Krankenhaus-Informationssystem  
Updated: (Apr 6, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...meierhofer text/html; charset=utf-8 MEIERHOFER AG - MCC. Krankenhaus-Informationssystem MEIERHOFER AG - Perspektiven erleben  HomePortfolioKlinikinformationssystemFachlösungenUnternehmenReferenzenKarriereVeranstaltungenAktuellesKontaktService-PortalSucheMensch, Medizin...Produktspektrum Mit der strategischen Beteiligung der MEIERHOFER AG an der Berliner samedi GmbH baut der...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 132 ] Publications - Church Lab  
Updated: (Oct 17, 2000)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Genome Resource: facilitating analyses of cancer and longevity-related adaptations. Bioinformatics pii: btu579. PMID: 25172923...JP (2014)Insights into the evolution of longevity from the bowhead whale genome. Cell Reports...J, Church GM (2009) Meta-analysis of ...-related gene expression profiles identifies common signatures of aging. Bioinformatics. Feb 2. PMID: 19189975185. Li JB...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 133 ] WHO | WHO Mortality Database  
Updated: (Oct 3, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...is a compilation of mortality data by ..., sex and cause of death, as reported annually by Member States from their civil registration systems. Access the online databaseNumber of deaths and ...-standardized death rates by country, year, cause, sex and ... are presented in a user-friendly application...death data by country, year, sex and .... Data since 1950 to date as coded...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 134 ] MIDUS - Midlife in the United States, A National Longitudinal Study of Health and Well-being  
Updated: (Nov 15, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...cognitive functioning contribute to changes in subjective ...., J Gerontol B Psychol Sci Soc...MIDUS NewslettersMIDJA (Midlife in Japan)Institute on Aging WebsiteNational Institute on Aging Website   ©2011 University of Wisconsin - Madison, Institute on Aging...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 135 ] MIDUS - Midlife in the United States, A National Longitudinal Study of Health and Well-being  
Updated: (Jan 5, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...change in adult mental health., Res Aging Andersson, M. ... , 2017,...MIDUS NewslettersMIDJA (Midlife in Japan)Institute on Aging WebsiteNational Institute on Aging Website   ©2011 University of Wisconsin - Madison, Institute on Aging...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 136 ] Welcome to the Health and Retirement Study  
Updated: (Apr 24, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Study A public resource for data on aging in America since 1990 For more than 20 years, the Health and Retirement Study (HRS) has been a leading source for information on the health and economic well-being of adults over ... 50 in the United States. We do...project sponsored by the National Institute on Aging (NIA U01AG009740) and the Social Security Administration...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 137 ] Life Expectancy for CP, VS, TBI and SCI  
Updated: (Oct 28, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...below computes the survival prognosis based on ..., sex, and level of disability. These results...functioning = 5) This is only for patients aged 20 and older. See the publication for details on the groups, and limitations of the results. Sex: Male Female ...: (e.g. 42)Disability Group: Not Specified...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 138 ] ELGA Calculator  
Updated: (Jul 15, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...-8 ELGA Calculator   Extremely Low Gestational ... (ELGA) Calculator Short-term (23 - 28 weeks) Neonatal Morbidity and Mortality Outcomes Gestational ... (in completed weeks): 23 24 25 26 27 28 Gestational ... is required. Singleton or twin pregnancy: Singleton...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 139 ] Hispanic Community Health Study/Study of Latinos: Sleep Apnea Risk Calculator  
Updated: (Jun 11, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Apnea Risk Calculator (Draft) Please provide Sex, ..., Height, Weight and Snoring Habit to obtain results. Sex MaleFemale ...    years Height  feet inches...cross-sectional data on Hispanic/Latino adults aged 18-74 years living in 4 U.S....
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 140 ] 1471-2105-10-5-S1  
Updated: (Jan 21, 2009)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...hyperparameters of the priors pd = pv = 1 ag = 2.0; bg = var0; ab = 1.0...0,ngene) temp3 = pv/(pi2)^nxy*bg^ag*gamma(nxy/2+ag)/gamma(ag) for (i in 1:ngene) { temp4 = (sum((x[i,]-ux[i])^2)+sum((y[i,]-ux[i]-d[i])^2))/2 temp1 = (1-pv)/(pi2*sqrt(var0))^nxy*exp(-temp4/var0) temp2 = temp3/(temp4+bg)^(nxy/2+ag) prob = temp2/(temp1+temp2) if (temp2 > 100000000...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 141 ] Materiali e Strumenti di Ricerca | dpss.unipd.it  
Updated: (Feb 17, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...– by Manfrinati, Sarlo, & Lotto Objective ... of Acquisition (AoA) - by Lotto, Surian, & Job Download Objective ... of Acquisition (AoA) - Appendix A Download Objective ... of Acquisition (AoA) - Appendix B Pyscholinguistic Database...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 142 ] SNP db  
Updated: (Sep 2, 2004)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...c T 2  5279 10956 558 ag aggctacatttgtctccagg acagcgttgtttgtgtttgt 1 11 80 a g A 2  5279 10834 680 ct agtagccagtctcctgttct agaagctggttgaatttgga 1 11 90 c t C 2  57977 376 707 at ctatccaacactaggttttc agccttgcagattttttctt 1 7 56 a t A 3  5279 10802 712 ag agtaatcttccagaaatgga aagcgcaagtaagtagccag 1 11 74 a g...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 143 ] AG Knapp  
Updated: (Apr 14, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...de/agknapp/ text/html; charset=utf-8 AG Knapp ContentNavigation HomeContactImpressumFreie Universität BerlinInstitute of Chemistry...Zacharias2014-12-16, 10:00 am (st)AG Wahl (Takustr. 6, 3.OG)Assessment of Binding Free Energy Calculations for Drug Design Nils Niggemann2014-05-15, 14:00 s.t.Semairraum der AG Wahl / Takustrasse 6 3. StockFast finite element...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Circular permuted proteins in the universe of protein folds.   Paper Page   (May 15, 2010)  
[ 144 ] Login for members:  
Updated: (Apr 30, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...small amounts of gluten at a young ... would prevent celiac disease, especially if this...B-36383–PREVENTCD). At the ... of 4 to 6 months, half of the children received 100 milligram of gluten daily. At the ... of 3 years 5.9 percent of...gluten for the first time at the ... of 6 months. In this group 4....
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 145 ] The Naked Mole-Rat Genome Resource  
Updated: (Dec 4, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...of resistance to disease, and diseases of ageing in particular. It is the longest-lived rodent and is exceptionally resistant to neoplasia, making it a unique model for research on ageing and cancer as well as other traits...available to allow easy discovery of known ageing genes.BLAST searchFor searching sequences you can...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 146 ] WebCite query result  
Updated: (Feb 19, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...not recruiting participants. Sponsor:National Institute on Aging (NIA)Information provided by (Responsible Party):National Institutes of Health Clinical Center (CC) ( National Institute on Aging (NIA) )ClinicalTrials.gov Identifier:NCT01331512First received: April...mobility difficulties that grow worse as they .... To better understand the reasons for mobility...original participants to assess the effects of aging on their mobility.Objectives:- To conduct a...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 147 ] Welcome to the Elder Financial Abuse | Research and Training site  
Updated: (Feb 14, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Research Education Tools Resources ContactBrunel Institute for Ageing Studies has produced a series of resources...1). Copyright © 2012 Brunel Institute for Ageing Studies. You can find our sitemap here...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 148 ] ShAPE-DALSP by JanHasenauer  
Updated: (Jul 30, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...and Parameter Estimation method (ShAPE) for Division-, ...- and Label-Structured Population (DALSP) modelsView on GitHub Download .zip Download .tar.gzFeaturesThe ShAPE-DALSP software package provides numerical methods for the simulation of division-, ...- and label-structured Population models. Furthermore, it...Allgöwer. Modeling and analysis of division-, ...-, and label-structured cell populations. In Proceedings...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 149 ] ADNI Home ADNI Home  
Updated: (Apr 16, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...affects one in three people over the ... of 65. Alzheimer’s is currently...risk of Alzheimer’s increases with ..., and the U.S. population is aging.Since 2004, the longitudinal Alzheimer’s...potential intervention. ADNI is seeking people over ... 55, who are healthy, as well as...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 150 ] LS Biologie der Mikroorganismen  
Updated: (Oct 15, 2007)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Biologie der MikroorganismenStartSekretariat MitarbeiterLehreForschungPublikationenRNA-SchwerpunktRNA-SURIBA  AG Angewandte MikrobiologiEAktuelles   Durchfallerreger misst KörpertemperaturMolekulares LegoCholera...32 23100Sprechstunde: Mi 10.00 - 11.00_______________________________AG Angewandte Mikrobiologie Prof. Dr. Julia Bandow Raum...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 151 ] Welcome to AGED Atlas  
Updated: (Jul 7, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
26149169 http://plantgrn.noble.org/AGED/ text/html; charset=us-ascii Welcome to AGED Atlas   Welcome to AGED The Alfalfa Gene Index and Expression Atlas...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 152 ] Data and Methods - Comparative Biology Group  
Updated: (Sep 29, 2011)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...solexa sequencing data from 20 male individuals aged between 14 and 58 years [Dataset 2] Technical replication of Dataset 1 [Dataset 3] Biological replication from a single 25-year-old individual Estimating accuracy of RNA-Seq and microarrays with proteomics (2009)[Dataset 1] RNA-Seq data from 5 male individuals aged between 8 and 53 years. (The number...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 153 ] Welcome to the Millennium Cohort Study - Centre for Longitudinal Studies  
Updated: (Dec 25, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...cohort members carried out so far – at ... nine months, three, five, seven and eleven years – have built up a uniquely detailed portrait of the children of the new century. The ... 11 Survey took place place in 2012...pages. CLS is currently carrying out the ... 14 survey, which is in field throughout 2015/early 2016. CLS will also carry out a new survey of the MCS cohort at ... 17 in 2018. The data The data...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 154 ] Citrus Canker: The Pathogen and Its Impact  
Updated: (Jun 22, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...branches up to a few years of ... (Fig. 21). Bacteria that ooze onto plant...to appear (22,58). As the lesions ..., they first turn light tan, then tan-to-brown, and a water-soaked margin appears, often surrounded by a chlorotic halo (Fig. 22). The water-soaked margin may disappear as lesions ..., and is not as prominent on resistant...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 155 ] Alberta Agriculture and Forestry  
Updated: (Jun 24, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...wanted to know about traceability, how to ... verify your calvesLearn more about completing the...you have an agricultural question? Call the Ag-Info Centre at 310-FARM (3276), toll free in Alberta.Spring Termination of Hayland Land Rental Spring Grazing Soil Temperature and Field Vegetable Germination More FAQs...InformationCropsLivestockAg EngineeringBusiness & EconomicsDiseases/Insects/ PestsFood & Ag ProcessingFood SafetyLearning & 4HMinistry InformationRural ServicesSoil/Water/AirStatisticsTradeWeather...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Erwinia amylovora: the molecular basis of fireblight disease.   Paper Page   (Nov 1, 2000)  
[ 156 ] WHO | Breastfeeding  
Updated: (Sep 3, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...is recommended up to 6 months of ..., with continued breastfeeding along with appropriate complementary foods up to two years of ... or beyond. General informationWorld Breastfeeding Week 2016Q&A: Up to what ... can a baby stay well nourished by...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 157 ] WebCite query result  
Updated: (Jan 27, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Accidents- Inclusion criteriaParents of children in the ... of 7 months (range 6-8 months...Safety Institute in the Netherlands for children aged 1-2 years (control group). Parents receive...child visit at the child¡¦s ... of 11 months. - Primary outcomeParents¡¦ child...most important cause of death among children aged 0-4 years old. It is also a great source of morbidity and loss of quality of life. In the Netherlands each year 24 children aged 0-4 years die caused by injuries in around the home. Additionally 44.000 children aged 0-4 years are medically treated, of...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 158 ] hsgsim.org - Hochschulgruppe Simulation  
Updated: (May 22, 2008)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Vordergrund.ArbeitsgruppenDynamische Simulation von Belebtschlammanlagen Hauptziel der AG "Dynamische Simulation von Belebtschlammanlagen" ist es, die Akzeptanz der dynamischen Simulation in der Praxis zu erhöhen. Integrierte ModellierungZiel der AG "Integrierte Modellierung" ist es, die Anwendung integrierter...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 159 ] healthsentry.net  
Updated: (Sep 26, 2003)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...allwaysync.com/promo#1 Worst ExerciseIt causes aging and weight-gain! Learn how to slow aging & burn fat www.maxworkouts.comBuy Dental HandpiecesNew...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 160 ] Sealed Envelope | BWHHS Prognostic model for incident locomotor disability in older adults  
Updated: (Feb 25, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...based on two British prospective cohort studies. ... and Ageing 2015; 44: 275-282. Online calculator by...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 161 ] Pictures and norms for psycholinguistic studies  
Updated: (May 1, 2003)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...agreement, conceptual familiarity, visual complexity, image variability, ... of acquisition, and naming latencies http://leadserv...agreement, conceptual familiarity, visual complexity, image variability, ... of acquisition, and naming latencies" by ...
MeSH:
[ 162 ] Biosystems Data Analysis Group  
Updated: (Jun 6, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...W. B. Hendriks, Paul H. C. Eilers, ... K. Smilde and Huub C. J. Hoefsloot...Ferdinand Roelfsema, Jan van der Greef, and ... K. Smilde Am J Physiol Endocrinol Metab...van Velzen, Huub C. J. Hoefsloot and ... K. Smilde Metabolomics: Springer link date 30...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 163 ] ORION fold recognition  
Updated: (Nov 21, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...dsimb.inserm.fr/ORION/References de Brevern, A.G., Etchebest, C., and Hazout, S. 2000. Bayesian probabilistic approach for predicting backbone structures in terms of protein blocks. Proteins 41: 271-287.Ghouzam Y, Postic G, de Brevern AG, Gelly JC. Improving protein fold recognition with...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 164 ] Benefit-Harm-Balance Calculator  
Updated: (Oct 1, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...harm chart shows, per women and men, ... category and according to 10-year outcome...if you are interested in a particular ... category 45-5455-6465-7475-84 Please...in %10-year risk for MI in %... 45-54>12%-15%  ...-10%>10% -15%>15% -20%>20% -25%... 55-64>12%-15%  ...
MeSH:
[ 165 ] RCT Tagger  
Updated: (Jun 6, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Adult: 19-24 yearsAdult: 19-44 yearsMiddle Aged + Aged: 45+ yearsMiddle Aged: 45-64 yearsAged: 65+ years80 and over...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 166 ] BioPhysConnectoR - AG Hamacher - Technische Universitaet Darmstadt  
Updated: (May 12, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...BioPhysConnectoR/ text/html; charset=us-ascii BioPhysConnectoR - AG Hamacher - Technische Universitaet DarmstadtDirekt zum InhaltTUD | Bio at TUD | AG HamacherHomeHome About Us License Documentation Download Publications Change Log AG Hamacher (ext.) BioPhysConnectoR Connecting Biology & Physics in...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 167 ] Plateforme GeT-Biopuces  
Updated: (Aug 28, 2008)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...de GeTAccès qPCR Biomark, séquençages Illumina, Pacbio et Sanger, ainsi qu'Ã...agebiologisteNathalie Marsaud Réalisation Services Séquenç... et Biopuces AffymetrixbiologisteDelphine Labourdette Design de microarrays...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 168 ] jcb.201301001  
Updated: (Aug 6, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...with 2 ml of 3–5% aged thioglycollate solution. On day 5 after injection...to pancreatic cancer by inhibiting oncogene-induced senescence. Cancer Cell. 19:728–739. doi...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 169 ] Systolic Blood Flow in the MCA  
Updated: (Feb 21, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...the MCA as a Function of Gestational ... Home >  Calculators > MCA Peak Systolic VelocityThe...times the median or higher.ENTER:Gestational ... (weeks) Observed MCA Peak Systolic Velocity (cm/sec)        Calculations:  The Median Peak Systolic Velocity for this ... is  Your measurement is  Multiples...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 170 ] FUTURAGE :: Final Road Map  
Updated: (Jul 16, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Road MapFinal Road MapRoad Map for European Ageing ResearchThe FUTURAGE Road Map for European Ageing Research can be downloaded here.A browsable...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[Ageing: research in Spain and europe].   Paper Page   (Jul, 2012)  
[ 171 ] aep.lib.rochester.edu  
Updated: (Feb 6, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...and more. AIDS touches individuals of all ages. On this website you will find posters...AIDS continues to affect people of all ages around the world, the purposes for which...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 172 ] PrediQt: A Post treatment Quality of Life prediction model for cervical cancer.  
Updated: (Mar 3, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...appear at the bottom of the page....(in years):MarriedVaginal Bleeding Present:yesnoVaginal Discharge Present:yesnoDyspareunia (Painful Intercourse)Abdominal Pain:PresentAbsentSignificant Weight LossParity (number of pregnancies carried to viable gestational ...):Nullipara-never given birthPrimipara-given birth onceMultipara...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 173 ] Data | Injury Biomechanics Laboratory  
Updated: (Jan 29, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...dimensional average head contours are available for ages ranging between one-month and ten-year-old specimens. Data is formatted as an .stl surface mesh, or a text file containing point coordinates. Contours for each ... group include separate average male and female...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 174 ] UOMO - The European Prostate Cancer Coalition UOMO - The European Prostate Cancer Coalition  
Updated: (Apr 16, 2007)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...If you are male and above the ... of 45, or have a male relative of that ..., you should read thisHome Our MembersEuropa Uomo...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Europa Uomo: the European Prostate Cancer Coalition.   Paper Page   (2007)  
[ 175 ] www.regstattools.org  
Updated: (Jan 8, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...number of cases (or deaths), for separate ...-groups (e.g. 5 years) and the...the person-years at risk for each ... group considered. Once the dataset has been...We reccomend to be at least 2 ... groups to perform RiskDiff, otherwise there is no evolution of the ... structure and changes can be only attributed...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 176 ] Genomic Paris Centre - IBENS  
Updated: (May 22, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...seq chez tous les eucaryotes. Séquenç... à haut débitVos échantillons sont...allons effectuer des tests de séquenç... des ARNm pleine longueur. EMPLOIS & FORMATIONSStage de Master11/10/2016Développement d’un outil d’analyse RNA-Seq combinant le séquenç... Illumina et Oxford Nanopore PUBLICATIONSCell Discovery2017Translation in...
MeSH:
[ 177 ] eldermet.ucc.ie  
Updated: (Jul 19, 2011)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...defense mechanisms or immune system. As people ..., these beneficial properties of the gut bacteria...expertise from ELDERMET are contributing to NU-... which is a large multidisciplinary consortium with...for Research and Technological Development. The NU-... project aims to explore how diet can...™ technologies. For more information on NU-... please click on the logo below.ELDERFOOD...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 178 ] .regstattools.net  
Updated: (May 15, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...1) descriptive analysis of frequencies (Crude Rates, ...-Standardized. Truncated Rates, Cumulative Risk) 2) Annual percent change of ...-standardized rates 3) Standardized incidence or mortality...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 179 ] Tools for Epilepsy | Appropriateness Study of Epilepsy Surgery  
Updated: (Aug 30, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...epilepsy surgery.Epilepsy affects people of all ages, gender, and socio-economic status.Epilepsy affects people of any ..., gender, and race or ethnicity. Years of...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 180 ] DIANA TOOLS - microT-CDS  
Updated: (Jun 24, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Reczko M, Filippidis C, Dalamagas T, Hatzigeorgiou AG., "DIANA-microT web server v5.0: service integration into miRNA functional analysis workflows.", Nucleic Acids Res. 2013 Jul;41(Web Server issue):W169-73.• Reczko M, Maragkakis M, Alexiou P, Grosse I, Hatzigeorgiou AG., "Functional microRNA targets in protein coding sequences...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 181 ] Danubian Biobank Consortium  
Updated: (Mar 31, 2008)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...objective(s) and state of the art Aging disorders related to vascular medicine and metabolic...for public utility in molecular medicine of aging disorders " that networks and expands all biobanking activities and the core scientific competences of the Danubian universities, teaching hospitals and rehabilitation clinics between Ulm and Budapest and of associated collaborating regional centers in the field of non-cancer aging disorders. In this context we will address...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
The Danubian Biobank project.   Paper Page   (2008)  
[ 182 ] Home  
Updated: (Feb 8, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Biosciences & ApplicationsNational Center for Scientific Research "Demokritos", Ag. Paraskevi 15310, Athens-Greece  v.1....BIOSCIENCES & APPLICATIONS, N.C.S.R. “DEMOKRITOS”, Ag. Paraskevi-Athens, Greece Tuesday the 2nd. Joomla...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 183 ] Enhancing Neuro Imaging Genetics Through Meta Analysis  
Updated: (Aug 1, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...turn, those tracts show exacerbated decline with aging. (Read more; run the program; download source code on the NITRC website)Heterochronicity of White Matter Development and Aging and Vulnerability to SchizophreniaKochunov Peter, Ganjgahi Halib...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 184 ] Fertility: Overview, 2009 to 2011  
Updated: (Jan 5, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...2011. In addition to the number of births, indicators analysed include the total fertility rate, ...-specific fertility rates, average ... of mother at childbirth, birth order, and completed fertility. When possible, recent trends are also...a woman would have over the course of her reproductive life if she experienced the ...-specific fertility rates observed in a particular calendar year. It is based on a compilation...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 185 ] 168  
Updated: (Sep 19, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...enhance arf2 phenotype, i.e., delayed leaf senescence resulting in more and larger leaves[77...regions determining enhanced leaf growth and delayed senescence in elevated CO2. Plant Cell Environ. 2006...Wilhelm WW, Nelson CJ. Leaf growth, leaf aging, and photosynthetic rate of tall fescue genotypes...mutants reveal functions in shoot growth, leaf senescence, seed size, germination, root development, and cytokinin...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 186 ] Neurodevelopmental MRI Database  
Updated: (Nov 17, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...based averages. The data are separated by ages in months, years, 6-month, or 5-year intervals (Ages and Templates). The templates are grouped into...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 187 ] Aurora-Project.eu  
Updated: (Jun 19, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...after breast cancer, among young European women aged 15-44. According to IARC estimates for...the majority of cases appear between the ages of 35 and 50, when women are...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 188 ] WormExp: Home  
Updated: (May 7, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...in C. elegans research, e.g. immunity, aging, development, food and stress response. Current version...TF Targets #161 Tissue #91 Development/Dauer/Aging #96 DAF/Insulin/food #146 Chemicals/stress...development, including the dauer stage, and during aging. DAF/Insulin/foodDifferentially expressed genes in mutants...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 189 ] ORION web server  
Updated: (Jun 20, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...articles.ReferencesGhouzam Y, Postic G, de Brevern AG, Gelly JC. Improving protein fold recognition with hybrid profiles combining sequence and structure evolution. Bioinformatics 2015, 31: 3782-9.Ghouzam Y, Postic G, Guerin PE, de Brevern AG, Gelly JC. ORION: a web server for...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 190 ] University of Iowa Rectal Surgery Risk Calculator  
Updated: (May 8, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...calculator requires numerical entries for White Count, ..., and Hematocrit to work.The risk model applies only to patients over 18 years of ... and excludes patients undergoing emergency procedures. The...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 191 ] Manitoba Follow-up Study Home Page  
Updated: (Jul 16, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...SPECTATORARCHIVED STORIES   Researchers interested in Successful Aging click here...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 192 ] BahlerLab: Home  
Updated: (Nov 6, 2006)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...laboratory studies genome regulation during cellular quiescence, ageing and stress response using fission yeast as...Genetics Institute, and the Institute of Healthy Ageing. Our research is mainly funded by a...
MeSH:
[ 193 ] Bayesian Bonetumor Probabilities  
Updated: (Oct 10, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...calculations provided herein. select sex femalemale select ... group (years) 01-45-910-1415-1920...metaphysealepi-meta-diaphysealmetaphysealmeta-diaphysealdiaphysealselect tumors to compare ..., localization and sex adjusted relative pretest probabilitieschondroblastic...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 194 ] Pharmaceuticals | Bayer - Home  
Updated: (Feb 14, 2005)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...and trendsCommitment + ResponsibilityEthics and transparencyFamily planningNeglected diseasesHealthy aging Bayer GlobalProductsMediaInvestorsCareersContact UsReport A Side EffectDeutschBayer GlobalProductsMediaInvestorsCareers...™re helping to fight it. Healthy aging Bayer to Acquire Monsanto Information about Bayer...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 195 ] Olfactory coding in insects - AG Galizia - Universität Konstanz  
Updated: (Feb 25, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...charset=us-ascii Olfactory coding in insects - AG Galizia - Universität Konstanzhttp://neuro.uni-konstanz...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 196 ] www.simonsz.net  
Updated: (Sep 16, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...2.1 (CSM21.zip)Predictive value of ..., angle, and refraction on reoperation and resolution...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 197 ] Forensic ChrX Research  
Updated: (Jun 19, 2006)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...klicken Sie bitte hier. © 2011 Qualitype AG...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 198 ] Drumpid - Index  
Updated: (Apr 8, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...them. Meik Kunz, Chunguang Liang, Alex Cecil, AG Dandekar, Department of Bioinformatics, University of Wuerzburg...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 199 ] Home - Nuffield Bioethics  
Updated: (Dec 14, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...research in global health emergenciesWorkshop: ethics of ageing researchPrevious workNaturalnessBiological and health dataThe culture of...maintaining human embryos in researchWorkshop: ethics of ageing researchWorkshop: research in global health emergenciesCosmetic proceduresGenome...slow or prevent the biological processes of ageing – …The Council held a workshop...human embryos in culture.Workshop: ethics of ageing researchThe Council held a workshop in November 2016 to consider the ethical, social and policy issues raised by research that seeks to slow or prevent the biological processes of ageing – …Workshop: research in global health...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 200 ] Start  
Updated: (Oct 21, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...ZieleDas KnorpelRegister DGOU ist eine Initiative der AG Klinische Geweberegeneration der DGOU. Nach vorausgehender Vorbereitungszeit...und Ellenbogenchirurgie (DVSE)Weitere TermineNewsStudiensekretariat FreiburgSitzung der AG Klinische Geweberegeneration auf dem DKOU 2016Aus organisatorischen...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 201 ] downloads  
Updated: (Sep 30, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...wir1_HC2Gene set file with point mutations (...) used in the analysis SomaticMutations.GBM_OV...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 202 ] Eczema | RCPCH  
Updated: (Nov 4, 2011)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...cheeks and/or extensor areas in children aged 18 months or under) personal history of dry skin in the last 12 months personal history of asthma or allergic rhinitis (or history of atopic disease in a first degree relative of children aged under four years) onset of signs and symptoms under the ... of two years (this criterion should not...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 203 ] GFR Calculator  
Updated: (Oct 25, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...times \textrm{INR}^{-0.113} \\ && \times \left( \textrm{...}^{-0.129} \left[ \textrm{years} \right] \right) \times \left( \textrm{sodium}^{0.972} \left[ \frac{\textrm{mmol}}{L} \right] \right) \\ && \times 1.236 \, (\textrm{if male}) \\ && \times 0.92 \, \left( \textrm{if} \, \frac{\textrm{moderate}}{\textrm{severe}} \, \textrm{ascites} \right) \ \end{eqnarray} $$ Units SIC (US)Gender Female Male ... yearsAscites Moderate or Severe Yes Creatinine Urea...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 204 ] Algorithms in Bioinformatics  
Updated: (Sep 24, 2013)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Arriola, L, Llamas, B, Breen, J, Morris, AG, Alt, KW, Caramelli, D, Dresely, V, Farrell, M, Farrer, AG, Francken, M, Gully, N, Haak, W, Hardy...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
Microbial Community Analysis Using MEGAN.   Paper Page   (2013)  
[ 205 ] AnnoTrack  
Updated: (Oct 13, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...splice_AT_AC_weak47   splice_GC_AG_alnDiff109   splice_GC_AG_none157   splice_GC_AG_suspect17   splice_GC_AG_weak1562   splice_GT_AG_alnDiff1583   splice_GT_AG_none2702   splice_GT_AG_suspect1853   splice_GT_AG_weak61937   splice_gap_alnDiff5   splice...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
AnnoTrack--a tracking system for genome annotation.   Paper Page   (Oct 5, 2010)  
[ 206 ] Submit Dictionary Words | Merriam-Webster  
Updated: (Feb 13, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Alphabetically: AhABCDEFGHIJKLMNOPQRSTUVWXYZotherAa Ab Ac Ad Ae Af Ag Ah Ai Aj Ak Al Am An...15:04ABCDEFGHIJKLMNOPQRSTUVWXYZotherAa Ab Ac Ad Ae Af Ag Ah Ai Aj Ak Al Am An...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 207 ] CCSMH - Canadian Coalition for Seniors' Mental Health  
Updated: (Dec 19, 2012)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...encountered in older persons. Compared to similarly aged individuals, older hospitalized persons who are delirious...000 in 1996 (National Advisory Council on Aging, 1999) and this number is continuing to...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 208 ] NITRC: Generation R Pediatric MRI Resources: Tool/Resource Info  
Updated: (Jul 15, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...respect to spatial normalization/registration. An average, ...-appropriate T1-weighted image, constructed from 130 typically developing children ages 6-to-10, is available. Further, a set of 25 resting-state ICA components are made available. The components were generated from 536 typically developing children, ages 6-to-10 years old. The components...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 209 ] 1471-2105-8-147-S4  
Updated: (Jun 5, 2007)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...06046 AITV 1.06046 LW 1.06046 AG 0.772779 E 0.654996 ADEG 0....-4 KQR -4 AKQR -4 DES -4 ... -4 DEGS -4 DEKS -4 GNS -4...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 210 ] gpc-ag.com  
Updated: (Oct 17, 2000)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
10958641 http://www.gpc-ag.com/win.html text/html; charset=utf...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 211 ] AAAS | Science's SAGE KE | Genes/Interventions Database  
Updated: (Jun 4, 2002)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...to their effects on life-span or ...-related neurological diseases. On 18 September 2006...Advertise   |   Find Products Science of Aging Knowledge Environment. ISSN 1539-6150 News ...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
AGEID: a database of aging genes and interventions.   Paper Page   (Apr 30, 2002)  
[ 212 ] Printed Word Database for 5-9 Year Olds - Home  
Updated: (Apr 7, 2010)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...printed word frequencies as read by children aged between 5 & 9.SEARCH THE DATABASEHistory ~...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 213 ] GoPubMed® - Transinsight's semantic search for the life sciences  
Updated: (Jun 27, 2005)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...million  Research Report 2.0 million  Middle Aged 1.0 million  Medicalization 0.8 million...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
GoPubMed: exploring PubMed with the Gene Ontology.   Paper Page   (Jul 1, 2005)  
[ 214 ] display_record.asp?ID=CRD42014008928  
Updated: (Apr 18, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...height measurement to predict small-for-gestational-... infants: a systematic review PROSPERO International prospective register of systematic reviews Symphysis-fundus height measurement to predict small-for-gestational-... infants: a systematic review Aase Serine Devold...height measurement to predict small-for-gestational-... infants: a systematic review. PROSPERO 2014:CRD42014008928...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 215 ] Osteosarcoma and metastasis  
Updated: (Jul 22, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...adults. Teens are the most commonly affected ... group, but osteosarcoma can occur at any .... In this way, osteosarcoma is the most...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 216 ] Merlin  
Updated: (Jun 17, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...html; charset=us-ascii Merlin MerlinAboutDemoQuick StartCIDARGITHUBMerlinM.A.G.E Optimization toolDeveloped by CIDAR BUGiven an...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 217 ] Rosy Sarmah  
Updated: (Oct 23, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Spatial Data Analysis" published by Verlag DM AG & Co, KG, Germany.Read more...© 2012...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 218 ] AERS Spider  
Updated: (Jul 29, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...consideration suspicious risk factors (indications, other drugs, ... groups). In addition, for the "drug to...mask" factors. By definition, all factors (indications, ... groups, and other drugs) with PRR value...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 219 ] Social Environment and Biomarkers of Aging Study (SEBAS) in Taiwan, 2000 and 2006  
Updated: (Mar 18, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...studies/3792/version/5 text/html; charset=iso-8859-1 Social Environment and Biomarkers of Aging Study (SEBAS) in Taiwan, 2000 and 2006Skip to Main ContentToggle navigation National Archive of Computerized...NotesDataset(s)Study DescriptionCitationFundingScope of StudyMethodologyVersion(s)Related PublicationsUtilitiesMetadata ExportsDownload StatisticsSocial Environment and Biomarkers of Aging Study (SEBAS) in Taiwan, 2000 and 2006 (ICPSR 3792) Principal Investigator(s): Weinstein, Maxine, Georgetown...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 220 ] Computational Biochemistry Group (Bayreuth)  
Updated: (Sep 21, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...for Aligning Type II Reaction Center Sequences AG Ullmann...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 221 ] WebCite query result  
Updated: (Jul 22, 2016)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...change?2. Does the efficacy vary with ...?3. Does the efficacy vary by the...obesityParticipants/ populationParents or carers of children/adolescents aged 0-18 years who are overweight or...group, characteristics of participants and children/adolescents (..., gender), setting, weight, height, BMI, percentage body...type of eHealth modality used and participant ... were not conducted due to the small number of studies and the wide range of ages within the individual studies making it difficult to analyse different ... groups (updated 26/08/15).Dissemination plansWe...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 222 ] Stroke Risk Estimator After TIA - The CIP Model  
Updated: (Dec 30, 2008)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Risk Estimator After TIAThe CIP Model1. ... ≥ 60 years Yes No2. History...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
[ 223 ] NFINgb - Nothobranchius furzeri Genome Browser  
Updated: (Dec 7, 2015)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...Analysis group of the Leibniz Institute on Aging - Fritz Lipmann Institute. The following genome assemblies...al.: Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived...
MeSH:
Pages linking to this site found by ...   Help
Google   Yahoo  
Papers citing this site found by ...   Help
BioMed Central   Scirus   HighWire Press   Google Scholar  
PubMed entry(s)   Help
[ 224 ] WHO | Tools for the prevention and control of NCDs  
Updated: (Aug 14, 2014)   Rate Avg: ☆☆☆☆☆ ( no ratings )  
...mortality Physical inactivityIndicator 6: AdolescentsIndicator 7: Persons aged 18+ years Salt/sodium intakeIndicator 8: Intake of salt Tobacco useIndicator 9: AdolescentsIndicator 10: Persons aged 18+ years Raised blood pressureIndicator 11: Prevalence among persons aged 18+ years Diabetes and obesityIndicator 12: DiabetesIndicator 13: Obesity in adolescentsIndicator 14: Obesity in persons aged 18+ years Additional indicatorsIndicator 15: Saturated fatty...
MeSH:
Pages linking to this site found by ...   Help